Cytoplazmatyczna nukleofosminina w ostrej białaczce szpikowej z normalnym kwasem cd

1. Mutacje NPM w 161 okazach białaczek szpikowych i nowotworach limfoidalnych. Przebadaliśmy 161 próbek pod kątem mutacji NPM: 52 próbki NPMc + AML, 56 NPMc-AML, 9 przypadków przewlekłej białaczki szpikowej i 44 nowotworów limfoidalnych (Tabela 1). Próbki od pięciu pacjentów z NPMc + AML analizowano zarówno w diagnozie, jak iw remisji. W celu analizy kodującego regionu NPM, .g RNA retrowirusowywano z użyciem systemu Thermoscript RT-PCR (Invitrogen). Następnie sekwencje cDNA zamplifikowano ze starterami NPM1_25F (5 GGTTGTTCTCTGGAGCAGCGTTC3 ) i NPM1_1112R (5 CCTGGACAACATTTATCAAACACGGTA3 ) z zastosowaniem systemu Expand High-FidelityPLUS PCR (Roche Applied Science). W celu powielenia sekwencji egzonu 12 NPM1 z genomowego DNA zaprojektowano dwa oligonukleotydy do przyłączenia się do flankujących sekwencji intronowych (NPM1-F [5 TTAACTCTCTGGTGGTAGAATGAA3 ] i NPM1-R [5 CAAGACTATTTGCCATTCCTAAC3 ]). Produkty PCR oczyszczone standardowymi metodami sekwencjonowano bezpośrednio z obu nici. Mutacje zostały potwierdzone przez ocenę niezależnych produktów PCR i, w reprezentatywnych przypadkach, przez klonowanie z pGEM-T Easy Vector Systems (Promega) i sekwencjonowanie.
Wektory ekspresji i testy transfekcji
Antyludzkie przeciwciała monoklonalne NPM reagują również z NPM z innych gatunków (w tym myszy). Aby śledzić lokalizację egzogennego NPM, wygenerowaliśmy plazmidy eksprymujące dzikiego typu (pEGFPc1-NPMwt) lub zmutowane (pEGFPc1-NPMmA) allele NPM poddane fuzji z ulepszonym białkiem o zielonej fluorescencji (EGFP). Sekwencje cDNA NPM w próbce NPMc + AML od pacjenta przenoszącego heterozygotyczną mutację w eksonie 12 amplifikowano za pomocą starterów NPM1_89F_BamHI (GCCACGGATCCGAAGATTCGATGGAC) i NPM1_1044R_EcoRI (ATCAAGAATTCCAGAAATGAAATAAGACG) i subklonowano w ramce do wektora pEGFPc1 (BD Biosciences Clontech). Analiza sekwencjonowania potwierdziła, że w żadnym z plazmidów nie wystąpiły żadne błędy wprowadzone przez Taq.
Komórki NIH-3T3 przejściowo transfekowano pEGFPc1-NPMwt, pEGFPc1-NPMmA i pustym wektorem pEGFPc1 przy użyciu odczynników Lipofectamine 2000 (Invitrogen). Skuteczność transfekcji monitorowano metodą Western blotting. Obrazy uzyskano za pomocą mikroskopu konfokalnego (Bio-Rad MRC-1024), przy użyciu oprogramowania Imaris do rekonstrukcji trójwymiarowej.
Analiza statystyczna
Analizę chi-kwadrat z dwukierunkowymi tabelami kontyngencji użyto do przetestowania powiązania między zmiennymi kategorycznymi. Różnice statystyczne między średnimi analizowano za pomocą testu t. Wielowymiarowy model logistyczny wykorzystano do analizy związków między liczbą białych krwinek podczas prezentacji, lokalizacją podkomórkowej NPM, mutacjami FLT3, a odpowiedzią na terapię indukcyjną u 126 chorych z AML i prawidłowym kariotypem (79 NPMc + i 47 NPMc-), którzy leczono zgodnie z protokołem GIMEMA LAM99P (indukcja, konsolidacja i terapia po konsolidacji [jak opisano w Dodatku Aneks 1A, dostępny wraz z pełnym tekstem tego artykułu na stronie www.nejm.org]). Analizy przeprowadzono za pomocą oprogramowania SAS (wersja 8.2). Dwustronne wartości P mniejsze niż 0,05 uważano za wskazujące na istotność statystyczną.
Wyniki
Przemieszczenie cytoplazmatyczne NPM
Rysunek 1
[hasła pokrewne: nfz poznań sanatoria lista oczekujących, sartany, syndrom dda ]
[patrz też: ciśnienie tętnicze normy, co to jest autyzm, codzienność w niepłodności ]